Review



mlb00c il6 elisa kit r d systems  (R&D Systems)


Bioz Verified Symbol R&D Systems is a verified supplier
Bioz Manufacturer Symbol R&D Systems manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 96
      Buy from Supplier

    Structured Review

    R&D Systems mlb00c il6 elisa kit r d systems
    Mlb00c Il6 Elisa Kit R D Systems, supplied by R&D Systems, used in various techniques. Bioz Stars score: 96/100, based on 882 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+il6+r/Mouse+IL-1+beta%2FIL-1F2+Quantikine+ELISA+Kit/pm41118770-232-61-65
    Average 96 stars, based on 882 article reviews
    mlb00c il6 elisa kit r d systems - by Bioz Stars, 2026-09
    96/100 stars

    Images



    Similar Products

    mlb00c il6 elisa kit r d systems  (R&D Systems)
    96
    R&D Systems mlb00c il6 elisa kit r d systems
    Mlb00c Il6 Elisa Kit R D Systems, supplied by R&D Systems, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+il6+r/Mouse+IL-1+beta%2FIL-1F2+Quantikine+ELISA+Kit/pm41118770-232-61-65
    Average 96 stars, based on 1 article reviews
    mlb00c il6 elisa kit r d systems - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier
    mouse-il6 r  (Sangon Biotech)
    90
    Sangon Biotech mouse-il6 r
    Mouse Il6 R, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+il6+r/mouse+il6+f/pmc10636326__pnas__2309032120__sapp-171-63-66
    Average 90 stars, based on 1 article reviews
    mouse-il6 r - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    r d systems il6  (R&D Systems)
    97
    R&D Systems r d systems il6
    R D Systems Il6, supplied by R&D Systems, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+il6+r/Mouse+IL-6+DuoSet+ELISA/10__1073_slash_pnas__2406492121-206-8-8
    Average 97 stars, based on 1 article reviews
    r d systems il6 - by Bioz Stars, 2026-09
    97/100 stars
    		  Buy from Supplier
    tagtccttcctaccccaatttcc idt n a mouse il6 r primer  (Danaher Inc)
    86
    Danaher Inc tagtccttcctaccccaatttcc idt n a mouse il6 r primer
    Tagtccttcctaccccaatttcc Idt N A Mouse Il6 R Primer, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+il6+r/pm37824329-319-16-24
    Average 86 stars, based on 1 article reviews
    tagtccttcctaccccaatttcc idt n a mouse il6 r primer - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    recombinant mouse hyper il6 r d systems  (R&D Systems)
    96
    R&D Systems recombinant mouse hyper il6 r d systems
    Figure 1. Response of <t>IL6</t> trans-signaling by tissue-resident cells of articular joint (A and B) Flow cytometric histogram (A) and quantitative gMFI (B) showing the expression of respective receptors in primary mouse chondrocytes. n = 3 biological replicates. gMFI, geometric mean fluorescence intensity. (C and D) Experimental design (C) and heatmap (D) showing the secretion of interleukins, chemokines, and matrix enzymes from cartilage explants (n = 3) treated with hyper IL6, sgp130Fc, or their combination at the indicated doses. Each cell of heatmap represents the average expression value of cytokines from three technical replicates. Cytokines were measured using Luminex assay. (E) Representative TRAP stain images of BMMs (isolated from wild-type, il6st/, and tnsrsf11a/ mice) treated with 50 ng/mL hyper IL6 or 100 ng/mL RANKL for 5 days. Scale bars, 500 mm. These micrographs are representative of three biological replicates for each group. (F) Surface area of TRAP-positive BMMs in (E) was measured using ImageJ software. Each dot represents the pixel size of an identified osteoclast. (G) Representative TRAP stain images of hyper IL6-induced BMMs treated with DMSO (<0.1%), 20 mg/mL AG490, or 5 mmol/L Stattic. Scale bars, 500 mm. These micrographs are representative of three biological replicates for each group. (H) Surface area of TRAP-positive BMMs in (G) was measured using ImageJ software. Each dot represents the pixel size of an identified osteoclast. The data are representative of two (A–D) or three (E–H) independent experiments with biologically independent samples. All data are presented as mean ± SEM. In (F) and (H), statistical significance was calculated using Kruskal-Wallis test with Dunn’s multiple comparisons test.
    Recombinant Mouse Hyper Il6 R D Systems, supplied by R&D Systems, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+il6+r/Mouse%2FRat+IGF-I%2FIGF-1+Quantikine+ELISA+Kit/pm37852176-212-271-275
    Average 96 stars, based on 1 article reviews
    recombinant mouse hyper il6 r d systems - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier
    mouse il6 duoset elisa r d systems cat  (R&D Systems)
    97
    R&D Systems mouse il6 duoset elisa r d systems cat
    Figure 1. Response of <t>IL6</t> trans-signaling by tissue-resident cells of articular joint (A and B) Flow cytometric histogram (A) and quantitative gMFI (B) showing the expression of respective receptors in primary mouse chondrocytes. n = 3 biological replicates. gMFI, geometric mean fluorescence intensity. (C and D) Experimental design (C) and heatmap (D) showing the secretion of interleukins, chemokines, and matrix enzymes from cartilage explants (n = 3) treated with hyper IL6, sgp130Fc, or their combination at the indicated doses. Each cell of heatmap represents the average expression value of cytokines from three technical replicates. Cytokines were measured using Luminex assay. (E) Representative TRAP stain images of BMMs (isolated from wild-type, il6st/, and tnsrsf11a/ mice) treated with 50 ng/mL hyper IL6 or 100 ng/mL RANKL for 5 days. Scale bars, 500 mm. These micrographs are representative of three biological replicates for each group. (F) Surface area of TRAP-positive BMMs in (E) was measured using ImageJ software. Each dot represents the pixel size of an identified osteoclast. (G) Representative TRAP stain images of hyper IL6-induced BMMs treated with DMSO (<0.1%), 20 mg/mL AG490, or 5 mmol/L Stattic. Scale bars, 500 mm. These micrographs are representative of three biological replicates for each group. (H) Surface area of TRAP-positive BMMs in (G) was measured using ImageJ software. Each dot represents the pixel size of an identified osteoclast. The data are representative of two (A–D) or three (E–H) independent experiments with biologically independent samples. All data are presented as mean ± SEM. In (F) and (H), statistical significance was calculated using Kruskal-Wallis test with Dunn’s multiple comparisons test.
    Mouse Il6 Duoset Elisa R D Systems Cat, supplied by R&D Systems, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+il6+r/Mouse+IL-6+DuoSet+ELISA/pm37018072-200-68-72
    Average 97 stars, based on 1 article reviews
    mouse il6 duoset elisa r d systems cat - by Bioz Stars, 2026-09
    97/100 stars
    		  Buy from Supplier
    mouse il6 dy406 r d systems  (R&D Systems)
    97
    R&D Systems mouse il6 dy406 r d systems
    Figure 1. Response of <t>IL6</t> trans-signaling by tissue-resident cells of articular joint (A and B) Flow cytometric histogram (A) and quantitative gMFI (B) showing the expression of respective receptors in primary mouse chondrocytes. n = 3 biological replicates. gMFI, geometric mean fluorescence intensity. (C and D) Experimental design (C) and heatmap (D) showing the secretion of interleukins, chemokines, and matrix enzymes from cartilage explants (n = 3) treated with hyper IL6, sgp130Fc, or their combination at the indicated doses. Each cell of heatmap represents the average expression value of cytokines from three technical replicates. Cytokines were measured using Luminex assay. (E) Representative TRAP stain images of BMMs (isolated from wild-type, il6st/, and tnsrsf11a/ mice) treated with 50 ng/mL hyper IL6 or 100 ng/mL RANKL for 5 days. Scale bars, 500 mm. These micrographs are representative of three biological replicates for each group. (F) Surface area of TRAP-positive BMMs in (E) was measured using ImageJ software. Each dot represents the pixel size of an identified osteoclast. (G) Representative TRAP stain images of hyper IL6-induced BMMs treated with DMSO (<0.1%), 20 mg/mL AG490, or 5 mmol/L Stattic. Scale bars, 500 mm. These micrographs are representative of three biological replicates for each group. (H) Surface area of TRAP-positive BMMs in (G) was measured using ImageJ software. Each dot represents the pixel size of an identified osteoclast. The data are representative of two (A–D) or three (E–H) independent experiments with biologically independent samples. All data are presented as mean ± SEM. In (F) and (H), statistical significance was calculated using Kruskal-Wallis test with Dunn’s multiple comparisons test.
    Mouse Il6 Dy406 R D Systems, supplied by R&D Systems, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+il6+r/Mouse+IL-6+DuoSet+ELISA/pm36001774-90-72-75
    Average 97 stars, based on 1 article reviews
    mouse il6 dy406 r d systems - by Bioz Stars, 2026-09
    97/100 stars
    		  Buy from Supplier
    r6132 il6 duoset sandwich elisa r d systems  (R&D Systems)
    97
    R&D Systems r6132 il6 duoset sandwich elisa r d systems
    Figure 1. Response of <t>IL6</t> trans-signaling by tissue-resident cells of articular joint (A and B) Flow cytometric histogram (A) and quantitative gMFI (B) showing the expression of respective receptors in primary mouse chondrocytes. n = 3 biological replicates. gMFI, geometric mean fluorescence intensity. (C and D) Experimental design (C) and heatmap (D) showing the secretion of interleukins, chemokines, and matrix enzymes from cartilage explants (n = 3) treated with hyper IL6, sgp130Fc, or their combination at the indicated doses. Each cell of heatmap represents the average expression value of cytokines from three technical replicates. Cytokines were measured using Luminex assay. (E) Representative TRAP stain images of BMMs (isolated from wild-type, il6st/, and tnsrsf11a/ mice) treated with 50 ng/mL hyper IL6 or 100 ng/mL RANKL for 5 days. Scale bars, 500 mm. These micrographs are representative of three biological replicates for each group. (F) Surface area of TRAP-positive BMMs in (E) was measured using ImageJ software. Each dot represents the pixel size of an identified osteoclast. (G) Representative TRAP stain images of hyper IL6-induced BMMs treated with DMSO (<0.1%), 20 mg/mL AG490, or 5 mmol/L Stattic. Scale bars, 500 mm. These micrographs are representative of three biological replicates for each group. (H) Surface area of TRAP-positive BMMs in (G) was measured using ImageJ software. Each dot represents the pixel size of an identified osteoclast. The data are representative of two (A–D) or three (E–H) independent experiments with biologically independent samples. All data are presented as mean ± SEM. In (F) and (H), statistical significance was calculated using Kruskal-Wallis test with Dunn’s multiple comparisons test.
    R6132 Il6 Duoset Sandwich Elisa R D Systems, supplied by R&D Systems, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+il6+r/Mouse+IL-6+DuoSet+ELISA/pm32049012-206-192-197
    Average 97 stars, based on 1 article reviews
    r6132 il6 duoset sandwich elisa r d systems - by Bioz Stars, 2026-09
    97/100 stars
    		  Buy from Supplier
    il6 r anti mouse sc 373708 hrp  (Santa Cruz Biotechnology)
    94
    Santa Cruz Biotechnology il6 r anti mouse sc 373708 hrp
    Figure 1. Response of <t>IL6</t> trans-signaling by tissue-resident cells of articular joint (A and B) Flow cytometric histogram (A) and quantitative gMFI (B) showing the expression of respective receptors in primary mouse chondrocytes. n = 3 biological replicates. gMFI, geometric mean fluorescence intensity. (C and D) Experimental design (C) and heatmap (D) showing the secretion of interleukins, chemokines, and matrix enzymes from cartilage explants (n = 3) treated with hyper IL6, sgp130Fc, or their combination at the indicated doses. Each cell of heatmap represents the average expression value of cytokines from three technical replicates. Cytokines were measured using Luminex assay. (E) Representative TRAP stain images of BMMs (isolated from wild-type, il6st/, and tnsrsf11a/ mice) treated with 50 ng/mL hyper IL6 or 100 ng/mL RANKL for 5 days. Scale bars, 500 mm. These micrographs are representative of three biological replicates for each group. (F) Surface area of TRAP-positive BMMs in (E) was measured using ImageJ software. Each dot represents the pixel size of an identified osteoclast. (G) Representative TRAP stain images of hyper IL6-induced BMMs treated with DMSO (<0.1%), 20 mg/mL AG490, or 5 mmol/L Stattic. Scale bars, 500 mm. These micrographs are representative of three biological replicates for each group. (H) Surface area of TRAP-positive BMMs in (G) was measured using ImageJ software. Each dot represents the pixel size of an identified osteoclast. The data are representative of two (A–D) or three (E–H) independent experiments with biologically independent samples. All data are presented as mean ± SEM. In (F) and (H), statistical significance was calculated using Kruskal-Wallis test with Dunn’s multiple comparisons test.
    Il6 R Anti Mouse Sc 373708 Hrp, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+il6+r/IL-6R%CE%B1+Antibody/pmc07474634-484-45-55
    Average 94 stars, based on 1 article reviews
    il6 r anti mouse sc 373708 hrp - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier

    Image Search Results


    Figure 1. Response of IL6 trans-signaling by tissue-resident cells of articular joint (A and B) Flow cytometric histogram (A) and quantitative gMFI (B) showing the expression of respective receptors in primary mouse chondrocytes. n = 3 biological replicates. gMFI, geometric mean fluorescence intensity. (C and D) Experimental design (C) and heatmap (D) showing the secretion of interleukins, chemokines, and matrix enzymes from cartilage explants (n = 3) treated with hyper IL6, sgp130Fc, or their combination at the indicated doses. Each cell of heatmap represents the average expression value of cytokines from three technical replicates. Cytokines were measured using Luminex assay. (E) Representative TRAP stain images of BMMs (isolated from wild-type, il6st/, and tnsrsf11a/ mice) treated with 50 ng/mL hyper IL6 or 100 ng/mL RANKL for 5 days. Scale bars, 500 mm. These micrographs are representative of three biological replicates for each group. (F) Surface area of TRAP-positive BMMs in (E) was measured using ImageJ software. Each dot represents the pixel size of an identified osteoclast. (G) Representative TRAP stain images of hyper IL6-induced BMMs treated with DMSO (<0.1%), 20 mg/mL AG490, or 5 mmol/L Stattic. Scale bars, 500 mm. These micrographs are representative of three biological replicates for each group. (H) Surface area of TRAP-positive BMMs in (G) was measured using ImageJ software. Each dot represents the pixel size of an identified osteoclast. The data are representative of two (A–D) or three (E–H) independent experiments with biologically independent samples. All data are presented as mean ± SEM. In (F) and (H), statistical significance was calculated using Kruskal-Wallis test with Dunn’s multiple comparisons test.

    Journal: Cell reports. Medicine

    Article Title: Replenishing decoy extracellular vesicles inhibits phenotype remodeling of tissue-resident cells in inflammation-driven arthritis.

    doi: 10.1016/j.xcrm.2023.101228

    Figure Lengend Snippet: Figure 1. Response of IL6 trans-signaling by tissue-resident cells of articular joint (A and B) Flow cytometric histogram (A) and quantitative gMFI (B) showing the expression of respective receptors in primary mouse chondrocytes. n = 3 biological replicates. gMFI, geometric mean fluorescence intensity. (C and D) Experimental design (C) and heatmap (D) showing the secretion of interleukins, chemokines, and matrix enzymes from cartilage explants (n = 3) treated with hyper IL6, sgp130Fc, or their combination at the indicated doses. Each cell of heatmap represents the average expression value of cytokines from three technical replicates. Cytokines were measured using Luminex assay. (E) Representative TRAP stain images of BMMs (isolated from wild-type, il6st/, and tnsrsf11a/ mice) treated with 50 ng/mL hyper IL6 or 100 ng/mL RANKL for 5 days. Scale bars, 500 mm. These micrographs are representative of three biological replicates for each group. (F) Surface area of TRAP-positive BMMs in (E) was measured using ImageJ software. Each dot represents the pixel size of an identified osteoclast. (G) Representative TRAP stain images of hyper IL6-induced BMMs treated with DMSO (<0.1%), 20 mg/mL AG490, or 5 mmol/L Stattic. Scale bars, 500 mm. These micrographs are representative of three biological replicates for each group. (H) Surface area of TRAP-positive BMMs in (G) was measured using ImageJ software. Each dot represents the pixel size of an identified osteoclast. The data are representative of two (A–D) or three (E–H) independent experiments with biologically independent samples. All data are presented as mean ± SEM. In (F) and (H), statistical significance was calculated using Kruskal-Wallis test with Dunn’s multiple comparisons test.

    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-GAPDH Abcam Cat# ab9485; RRID: AB_307275 Rabbit anti-IL6ST Abcam Cat# ab283685 Rabbit anti-eGFP Bioss Cat# bs-2194R; RRID: AB_10881247 Rabbit anti-mCherry Bioss Cat# bs-41161R Rabbit anti-TIMP1 Bioss Cat# bs-0415R; RRID: AB_10856775 Rabbit anti-TIMP3 Abcam Cat# ab277794 Rabbit anti-ADAMTS4 Bioss Cat# bs-4191R; RRID: AB_11073215 Rabbit anti-ADAMTS5 Bioss Cat# bs-3573R; RRID: AB_10856276 Rabbit anti-RUNX2 Bioss Cat# bs-1134R; RRID: AB_10856062 Rabbit anti-MMP1 Bioss Cat# bs-0424R; RRID: AB_10858058 Rabbit anti-STAT3 Bioss Cat# bsm-52235R Rabbit anti-pSTAT3 Bioss Cat# bs-1658R;RRID: AB_10855117 Goat anti-rabbit IgG Bioss Cat# bs-0295G; RRID: AB_10856483 Rabbit anti-mIL6R Bioss Cat# bs-23660R Rabbit anti-MMP13 Bioss Cat# bs-10250R Rabbit anti-IL6ST BioLegend Cat# 149401; RRID: AB_2565294 Rabbit anti-mIL6R BioLegend Cat# 115803; RRID: AB_313674 Rabbit anti-IL1RII Abcam Cat# ab212208 Mouse anti-TNFR1 Abcam Cat# ab194814; RRID: AB_2889242 Goat anti-rabbit IgG H&L (Alexa Fluor 488) Abcam Cat# ab150077; RRID: AB_2630356 Goat anti-mouse IgG H&L (Alexa Fluor 488) Abcam Cat# ab150113; RRID: AB_2576208 Rabbit anti-CD81 Abcam Cat# ab109201; RRID: AB_10866464 Rabbit anti-CD9 Abcam Cat# ab307085 Rabbit anti-TSG101 Abcam Cat# ab125011; RRID: AB_10974262 Rabbit anti-HSP27 Abcam Cat# ab12351; RRID: AB_299035 Rabbit anti-b Tubulin Abcam Cat# ab6046; RRID: AB_2210370 Rabbit anti-TNFR1 Abcam Cat# ab223352 Rabbit anti-IL1RII Abcam Cat# ab273025 Biological samples Primary mouse chondrocytes C57BL/6 mice in this study N/A Mouse bone marrow macrophages C57BL/6 mice in this study N/A Chemicals, peptides, and recombinant proteins Collagenase D Roche Cat# roche.11088858001 Fetal bovine serum Hyclone Cat# SH30406.02 Recombinant mouse M-CSF R&D Systems Cat# 416-ML-050/CF Recombinant mouse RANKL R&D Systems Cat# 462-TR-010/CF Recombinant human TNFa R&D Systems Cat# 210-TA-020 Recombinant human IL1b Sigma-Aldrichs Cat# SRP3083 Recombinant human gp130Fc R&D Systems Cat# 671-GP-100 Recombinant mouse gp130Fc R&D Systems Cat# 468-MG-100 Recombinant mouse hyper IL6 R&D Systems Cat# 9038-SR-025 (Continued on next page) Cell Reports Medicine 4, 101228, October 17, 2023 e1

    Techniques: Expressing, Luminex, Staining, Isolation, Software

    Figure 2. Inflammatory stimulation promotes the release of IL6ST-bearing decoy EVs (A) EV quantification in blood and liver samples from DBA/1J (n = 3), K/BxN STA (n = 6), CIA (n = 6), or EAM mice (n = 3) using nanoparticle tracking analysis (NTA). (B and C) Protein lysates were collected from serum EVs from DBA/1J, K/BxN STA, CIA, and EAM mice. Representative western blot (B) and quantification analysis (C) of IL6ST are shown. b-tubulin was used as a loading control. n = 3 mice each group. (D) Representative transmission electron micrographs of serum EVs from indicated mouse models. Scale bars, 100 nm. (E) Total estimated number of IL6ST receptors per EV from serum of DBA/1J (n = 2), K/BxN STA (n = 6), CIA (n = 6), or EAM mice (n = 3) estimated based on obtained MFI values after fluorescence calibration of with Quantibrite polyethylene (PE) beads by flow cytometry. (F) Relative intensities of SEAP signal in HEK-Blue IL6 reporter cells induced by 10 ng/mL hyper IL6 and treated with 5 3 108 EV isolated from DBA/1J, K/BxN STA, CIA, or EAM mice. Data were normalized to HEK-Blue IL6 reporter cells treated with mock. Treatment with 200 ng/mL sgp130Fc was used as a positive control. n = 3 biological triplicates. Each dot represents the average value of three technical replicates. (G) Experimental design for EV transfer from K/BxN STA model mice to recipient CIA mice. (H and I) Clinical arthritis score over time (H) and at the endpoint (day 52) (I) in CIA mice treated with saline (n = 3), K/BxN STA mouse EVs (n = 5), or K/BxN STA mouse EVs preincubated with IL6ST mAb (n = 3) or IgG control (n = 3) recorded at the indicated time points. Each mouse was intravenously injected with 5 3 1010

    Journal: Cell reports. Medicine

    Article Title: Replenishing decoy extracellular vesicles inhibits phenotype remodeling of tissue-resident cells in inflammation-driven arthritis.

    doi: 10.1016/j.xcrm.2023.101228

    Figure Lengend Snippet: Figure 2. Inflammatory stimulation promotes the release of IL6ST-bearing decoy EVs (A) EV quantification in blood and liver samples from DBA/1J (n = 3), K/BxN STA (n = 6), CIA (n = 6), or EAM mice (n = 3) using nanoparticle tracking analysis (NTA). (B and C) Protein lysates were collected from serum EVs from DBA/1J, K/BxN STA, CIA, and EAM mice. Representative western blot (B) and quantification analysis (C) of IL6ST are shown. b-tubulin was used as a loading control. n = 3 mice each group. (D) Representative transmission electron micrographs of serum EVs from indicated mouse models. Scale bars, 100 nm. (E) Total estimated number of IL6ST receptors per EV from serum of DBA/1J (n = 2), K/BxN STA (n = 6), CIA (n = 6), or EAM mice (n = 3) estimated based on obtained MFI values after fluorescence calibration of with Quantibrite polyethylene (PE) beads by flow cytometry. (F) Relative intensities of SEAP signal in HEK-Blue IL6 reporter cells induced by 10 ng/mL hyper IL6 and treated with 5 3 108 EV isolated from DBA/1J, K/BxN STA, CIA, or EAM mice. Data were normalized to HEK-Blue IL6 reporter cells treated with mock. Treatment with 200 ng/mL sgp130Fc was used as a positive control. n = 3 biological triplicates. Each dot represents the average value of three technical replicates. (G) Experimental design for EV transfer from K/BxN STA model mice to recipient CIA mice. (H and I) Clinical arthritis score over time (H) and at the endpoint (day 52) (I) in CIA mice treated with saline (n = 3), K/BxN STA mouse EVs (n = 5), or K/BxN STA mouse EVs preincubated with IL6ST mAb (n = 3) or IgG control (n = 3) recorded at the indicated time points. Each mouse was intravenously injected with 5 3 1010

    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-GAPDH Abcam Cat# ab9485; RRID: AB_307275 Rabbit anti-IL6ST Abcam Cat# ab283685 Rabbit anti-eGFP Bioss Cat# bs-2194R; RRID: AB_10881247 Rabbit anti-mCherry Bioss Cat# bs-41161R Rabbit anti-TIMP1 Bioss Cat# bs-0415R; RRID: AB_10856775 Rabbit anti-TIMP3 Abcam Cat# ab277794 Rabbit anti-ADAMTS4 Bioss Cat# bs-4191R; RRID: AB_11073215 Rabbit anti-ADAMTS5 Bioss Cat# bs-3573R; RRID: AB_10856276 Rabbit anti-RUNX2 Bioss Cat# bs-1134R; RRID: AB_10856062 Rabbit anti-MMP1 Bioss Cat# bs-0424R; RRID: AB_10858058 Rabbit anti-STAT3 Bioss Cat# bsm-52235R Rabbit anti-pSTAT3 Bioss Cat# bs-1658R;RRID: AB_10855117 Goat anti-rabbit IgG Bioss Cat# bs-0295G; RRID: AB_10856483 Rabbit anti-mIL6R Bioss Cat# bs-23660R Rabbit anti-MMP13 Bioss Cat# bs-10250R Rabbit anti-IL6ST BioLegend Cat# 149401; RRID: AB_2565294 Rabbit anti-mIL6R BioLegend Cat# 115803; RRID: AB_313674 Rabbit anti-IL1RII Abcam Cat# ab212208 Mouse anti-TNFR1 Abcam Cat# ab194814; RRID: AB_2889242 Goat anti-rabbit IgG H&L (Alexa Fluor 488) Abcam Cat# ab150077; RRID: AB_2630356 Goat anti-mouse IgG H&L (Alexa Fluor 488) Abcam Cat# ab150113; RRID: AB_2576208 Rabbit anti-CD81 Abcam Cat# ab109201; RRID: AB_10866464 Rabbit anti-CD9 Abcam Cat# ab307085 Rabbit anti-TSG101 Abcam Cat# ab125011; RRID: AB_10974262 Rabbit anti-HSP27 Abcam Cat# ab12351; RRID: AB_299035 Rabbit anti-b Tubulin Abcam Cat# ab6046; RRID: AB_2210370 Rabbit anti-TNFR1 Abcam Cat# ab223352 Rabbit anti-IL1RII Abcam Cat# ab273025 Biological samples Primary mouse chondrocytes C57BL/6 mice in this study N/A Mouse bone marrow macrophages C57BL/6 mice in this study N/A Chemicals, peptides, and recombinant proteins Collagenase D Roche Cat# roche.11088858001 Fetal bovine serum Hyclone Cat# SH30406.02 Recombinant mouse M-CSF R&D Systems Cat# 416-ML-050/CF Recombinant mouse RANKL R&D Systems Cat# 462-TR-010/CF Recombinant human TNFa R&D Systems Cat# 210-TA-020 Recombinant human IL1b Sigma-Aldrichs Cat# SRP3083 Recombinant human gp130Fc R&D Systems Cat# 671-GP-100 Recombinant mouse gp130Fc R&D Systems Cat# 468-MG-100 Recombinant mouse hyper IL6 R&D Systems Cat# 9038-SR-025 (Continued on next page) Cell Reports Medicine 4, 101228, October 17, 2023 e1

    Techniques: Western Blot, Control, Transmission Assay, Cytometry, Isolation, Positive Control, Saline, Injection

    Figure 3. Construction of engineered IL6ST decoy EVs by surface display of chimeric proteins (A) Schematic of DNA constructs expressing IL6ST-eGFP-CD63 and IL6ST-mCherry-syntenin. (B) Predicted accurate model building for the intracellular, extracellular, and transmembrane domains of IL6ST-eGFP-CD63 (pLDDT = 84.25), or IL6ST-syntenin (pLDDT = 81.22). A, Ig-like C2-type; B, fibronectin type-III 1; C, fibronectin type-III 2; D, fibronectin type-III 3; E, fibronectin type-III 4; F, fibronectin type-III 5; pLDDT greater than 70 indicates that the predicted structure has a high degree of confidence. pLDDT, predicted local-distance difference test. (C) Schematic diagram showing two types of IL6ST decoy EVs obtained by fusing IL6ST to EV-sorting proteins in tandem with fluorescent proteins. (D) Relative intensities of SEAP signal in HEK-Blue IL6 reporter cells induced by 10 ng/mL of either hyper IL-6 (left) or IL6 (right) and treated with wild-type EVs, IL6ST-CD63 EVs, or IL6ST-syntenin EVs at the indicated doses. n = 3 biological replicates. Data were normalized to cells treated with wild-type EVs. (E) Protein lysates was collected from IL6ST decoy EVs or their donor cells. Western blot analysis was performed examining IL6ST, mCherry and eGFP. b-tubulin was used as a loading control. Specific bands corresponding to the predicted molecular weight of chimeric proteins are indicated by the black boxes. (F) Representative fluorescence images showing IL6ST decoy EVs labeled with eGFP (green) or mCherry (red) are internalized by HEK293 cells. Scale bars, 10 mm.

    Journal: Cell reports. Medicine

    Article Title: Replenishing decoy extracellular vesicles inhibits phenotype remodeling of tissue-resident cells in inflammation-driven arthritis.

    doi: 10.1016/j.xcrm.2023.101228

    Figure Lengend Snippet: Figure 3. Construction of engineered IL6ST decoy EVs by surface display of chimeric proteins (A) Schematic of DNA constructs expressing IL6ST-eGFP-CD63 and IL6ST-mCherry-syntenin. (B) Predicted accurate model building for the intracellular, extracellular, and transmembrane domains of IL6ST-eGFP-CD63 (pLDDT = 84.25), or IL6ST-syntenin (pLDDT = 81.22). A, Ig-like C2-type; B, fibronectin type-III 1; C, fibronectin type-III 2; D, fibronectin type-III 3; E, fibronectin type-III 4; F, fibronectin type-III 5; pLDDT greater than 70 indicates that the predicted structure has a high degree of confidence. pLDDT, predicted local-distance difference test. (C) Schematic diagram showing two types of IL6ST decoy EVs obtained by fusing IL6ST to EV-sorting proteins in tandem with fluorescent proteins. (D) Relative intensities of SEAP signal in HEK-Blue IL6 reporter cells induced by 10 ng/mL of either hyper IL-6 (left) or IL6 (right) and treated with wild-type EVs, IL6ST-CD63 EVs, or IL6ST-syntenin EVs at the indicated doses. n = 3 biological replicates. Data were normalized to cells treated with wild-type EVs. (E) Protein lysates was collected from IL6ST decoy EVs or their donor cells. Western blot analysis was performed examining IL6ST, mCherry and eGFP. b-tubulin was used as a loading control. Specific bands corresponding to the predicted molecular weight of chimeric proteins are indicated by the black boxes. (F) Representative fluorescence images showing IL6ST decoy EVs labeled with eGFP (green) or mCherry (red) are internalized by HEK293 cells. Scale bars, 10 mm.

    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-GAPDH Abcam Cat# ab9485; RRID: AB_307275 Rabbit anti-IL6ST Abcam Cat# ab283685 Rabbit anti-eGFP Bioss Cat# bs-2194R; RRID: AB_10881247 Rabbit anti-mCherry Bioss Cat# bs-41161R Rabbit anti-TIMP1 Bioss Cat# bs-0415R; RRID: AB_10856775 Rabbit anti-TIMP3 Abcam Cat# ab277794 Rabbit anti-ADAMTS4 Bioss Cat# bs-4191R; RRID: AB_11073215 Rabbit anti-ADAMTS5 Bioss Cat# bs-3573R; RRID: AB_10856276 Rabbit anti-RUNX2 Bioss Cat# bs-1134R; RRID: AB_10856062 Rabbit anti-MMP1 Bioss Cat# bs-0424R; RRID: AB_10858058 Rabbit anti-STAT3 Bioss Cat# bsm-52235R Rabbit anti-pSTAT3 Bioss Cat# bs-1658R;RRID: AB_10855117 Goat anti-rabbit IgG Bioss Cat# bs-0295G; RRID: AB_10856483 Rabbit anti-mIL6R Bioss Cat# bs-23660R Rabbit anti-MMP13 Bioss Cat# bs-10250R Rabbit anti-IL6ST BioLegend Cat# 149401; RRID: AB_2565294 Rabbit anti-mIL6R BioLegend Cat# 115803; RRID: AB_313674 Rabbit anti-IL1RII Abcam Cat# ab212208 Mouse anti-TNFR1 Abcam Cat# ab194814; RRID: AB_2889242 Goat anti-rabbit IgG H&L (Alexa Fluor 488) Abcam Cat# ab150077; RRID: AB_2630356 Goat anti-mouse IgG H&L (Alexa Fluor 488) Abcam Cat# ab150113; RRID: AB_2576208 Rabbit anti-CD81 Abcam Cat# ab109201; RRID: AB_10866464 Rabbit anti-CD9 Abcam Cat# ab307085 Rabbit anti-TSG101 Abcam Cat# ab125011; RRID: AB_10974262 Rabbit anti-HSP27 Abcam Cat# ab12351; RRID: AB_299035 Rabbit anti-b Tubulin Abcam Cat# ab6046; RRID: AB_2210370 Rabbit anti-TNFR1 Abcam Cat# ab223352 Rabbit anti-IL1RII Abcam Cat# ab273025 Biological samples Primary mouse chondrocytes C57BL/6 mice in this study N/A Mouse bone marrow macrophages C57BL/6 mice in this study N/A Chemicals, peptides, and recombinant proteins Collagenase D Roche Cat# roche.11088858001 Fetal bovine serum Hyclone Cat# SH30406.02 Recombinant mouse M-CSF R&D Systems Cat# 416-ML-050/CF Recombinant mouse RANKL R&D Systems Cat# 462-TR-010/CF Recombinant human TNFa R&D Systems Cat# 210-TA-020 Recombinant human IL1b Sigma-Aldrichs Cat# SRP3083 Recombinant human gp130Fc R&D Systems Cat# 671-GP-100 Recombinant mouse gp130Fc R&D Systems Cat# 468-MG-100 Recombinant mouse hyper IL6 R&D Systems Cat# 9038-SR-025 (Continued on next page) Cell Reports Medicine 4, 101228, October 17, 2023 e1

    Techniques: Construct, Expressing, Western Blot, Control, Molecular Weight, Labeling

    Figure 4. Co-expression of chimeric proteins optimizes the display of decoy receptors (A) Schematic diagram of the arrangement at the EV membrane of IL6ST fused to the sorting proteins in tandem with fluorescent proteins. (B) Representative transmission electron micrographs of decoy EVs with nanogold-labeled antibodies staining of IL6ST. Scale bars, 100 nm. Nanogold-labeled IgG antibodies was used as a negative control. These micrographs are representative of over 10 such images for each group. (C) Quantification of nanogold-labeled IL6ST epitopes at the EV membrane. The dot plot represents the number of nanogold particles from individual micro- graphs. n = 10 images each group. (D) Total estimated number of IL6ST receptors per EV estimated based on obtained MFI values after fluorescence calibration of with Quantibrite PE beads by flow cytometry. n = 3 biological replicates. (E) Heatmap showing the expression of interleukins, chemokines, and matrix enzymes in the supernatant of mouse cartilage explants treated with 50 ng/mL hyper IL6 and increasing doses of decoy EVs. Each cell of heatmap represents the average expression value of cytokines from three biological replicates. Cytokines were measured using Luminex assay. (F) Quantitative analysis showing the expression of six matrix enzymes in the supernatant of mouse cartilage explants treated with 50 ng/mL hyper IL6 and 3 3 109/mL decoy EVs. Each dot represents the average expression value of cytokines from three biological replicates. Cytokines were measured using Luminex assay.

    Journal: Cell reports. Medicine

    Article Title: Replenishing decoy extracellular vesicles inhibits phenotype remodeling of tissue-resident cells in inflammation-driven arthritis.

    doi: 10.1016/j.xcrm.2023.101228

    Figure Lengend Snippet: Figure 4. Co-expression of chimeric proteins optimizes the display of decoy receptors (A) Schematic diagram of the arrangement at the EV membrane of IL6ST fused to the sorting proteins in tandem with fluorescent proteins. (B) Representative transmission electron micrographs of decoy EVs with nanogold-labeled antibodies staining of IL6ST. Scale bars, 100 nm. Nanogold-labeled IgG antibodies was used as a negative control. These micrographs are representative of over 10 such images for each group. (C) Quantification of nanogold-labeled IL6ST epitopes at the EV membrane. The dot plot represents the number of nanogold particles from individual micro- graphs. n = 10 images each group. (D) Total estimated number of IL6ST receptors per EV estimated based on obtained MFI values after fluorescence calibration of with Quantibrite PE beads by flow cytometry. n = 3 biological replicates. (E) Heatmap showing the expression of interleukins, chemokines, and matrix enzymes in the supernatant of mouse cartilage explants treated with 50 ng/mL hyper IL6 and increasing doses of decoy EVs. Each cell of heatmap represents the average expression value of cytokines from three biological replicates. Cytokines were measured using Luminex assay. (F) Quantitative analysis showing the expression of six matrix enzymes in the supernatant of mouse cartilage explants treated with 50 ng/mL hyper IL6 and 3 3 109/mL decoy EVs. Each dot represents the average expression value of cytokines from three biological replicates. Cytokines were measured using Luminex assay.

    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-GAPDH Abcam Cat# ab9485; RRID: AB_307275 Rabbit anti-IL6ST Abcam Cat# ab283685 Rabbit anti-eGFP Bioss Cat# bs-2194R; RRID: AB_10881247 Rabbit anti-mCherry Bioss Cat# bs-41161R Rabbit anti-TIMP1 Bioss Cat# bs-0415R; RRID: AB_10856775 Rabbit anti-TIMP3 Abcam Cat# ab277794 Rabbit anti-ADAMTS4 Bioss Cat# bs-4191R; RRID: AB_11073215 Rabbit anti-ADAMTS5 Bioss Cat# bs-3573R; RRID: AB_10856276 Rabbit anti-RUNX2 Bioss Cat# bs-1134R; RRID: AB_10856062 Rabbit anti-MMP1 Bioss Cat# bs-0424R; RRID: AB_10858058 Rabbit anti-STAT3 Bioss Cat# bsm-52235R Rabbit anti-pSTAT3 Bioss Cat# bs-1658R;RRID: AB_10855117 Goat anti-rabbit IgG Bioss Cat# bs-0295G; RRID: AB_10856483 Rabbit anti-mIL6R Bioss Cat# bs-23660R Rabbit anti-MMP13 Bioss Cat# bs-10250R Rabbit anti-IL6ST BioLegend Cat# 149401; RRID: AB_2565294 Rabbit anti-mIL6R BioLegend Cat# 115803; RRID: AB_313674 Rabbit anti-IL1RII Abcam Cat# ab212208 Mouse anti-TNFR1 Abcam Cat# ab194814; RRID: AB_2889242 Goat anti-rabbit IgG H&L (Alexa Fluor 488) Abcam Cat# ab150077; RRID: AB_2630356 Goat anti-mouse IgG H&L (Alexa Fluor 488) Abcam Cat# ab150113; RRID: AB_2576208 Rabbit anti-CD81 Abcam Cat# ab109201; RRID: AB_10866464 Rabbit anti-CD9 Abcam Cat# ab307085 Rabbit anti-TSG101 Abcam Cat# ab125011; RRID: AB_10974262 Rabbit anti-HSP27 Abcam Cat# ab12351; RRID: AB_299035 Rabbit anti-b Tubulin Abcam Cat# ab6046; RRID: AB_2210370 Rabbit anti-TNFR1 Abcam Cat# ab223352 Rabbit anti-IL1RII Abcam Cat# ab273025 Biological samples Primary mouse chondrocytes C57BL/6 mice in this study N/A Mouse bone marrow macrophages C57BL/6 mice in this study N/A Chemicals, peptides, and recombinant proteins Collagenase D Roche Cat# roche.11088858001 Fetal bovine serum Hyclone Cat# SH30406.02 Recombinant mouse M-CSF R&D Systems Cat# 416-ML-050/CF Recombinant mouse RANKL R&D Systems Cat# 462-TR-010/CF Recombinant human TNFa R&D Systems Cat# 210-TA-020 Recombinant human IL1b Sigma-Aldrichs Cat# SRP3083 Recombinant human gp130Fc R&D Systems Cat# 671-GP-100 Recombinant mouse gp130Fc R&D Systems Cat# 468-MG-100 Recombinant mouse hyper IL6 R&D Systems Cat# 9038-SR-025 (Continued on next page) Cell Reports Medicine 4, 101228, October 17, 2023 e1

    Techniques: Expressing, Membrane, Transmission Assay, Labeling, Staining, Negative Control, Cytometry, Luminex